Lenguaje de Programación R Jobs
R is an open source programming language for statistical computing and graphics, it is widely used by statisticians and data miners.
Contratar a R ProgrammersRequires knowledge of excel ;supply chain ; inventory modeling ; eoq model; stochastic inventory models etc
Sampling theory & application assignments, 4 questions, not too long
Real Estate Finance in R Studio. R Code with brief comments
Coding for Real Estate Finance, estimated time for someone experienced: 1-2h. Supporting documents will be provided. I would need it today 8 pm CET. I need R Code with brief comments
Coding for Real Estate Finance Supporting documents will be provided. I would need it today 11pm CET. Deliverables R Code with brief comments
I am doing a research on the effect of asylum seeker reception centers on the property value of nearby houses. For this I need to preform a difference in difference analysis (hedonic price model) in fact it is a multi regression. I need some help with creating dummies and preform some other actions. Is there someone out here that is good with STATA?
Data Analyst Experte, R Programming gesucht Suche einen Experten für Datenbankenanalyse in R der bei einem privaten Projekt behilflich sein kann. Grob umschrieben die Hilfe zuerst bei 1) Daten Cleaning > Daten auf den selben Nenner bringen, damit sie verglichen werden können und dann 2) die Daten (es handelt sich im Zeitreihendaten für 12 Jahre Zeitraum) mit Hilfe einer passenden...
Assignment Topic includes Regression, Hypothesis, Scatterplot, Sampling, Confidence Interval, etc
We are looking for statistics writers for long term work, urgently need to be done a biostatistics task using R programming. Once we contact, you have to provide your previous writing samples (note that not stolen ones). If you are interested, answer the following questions: 1. Your highest education degree and subject? 2. Which types of writing experiences do you have? 3. What referencing styles...
Need to run Monte Carlo Simulations on the provide data.
I am trying to evaluate an optimal purchase strategy for a battery storage. I have a data set with bid and ask prices and would like to have the best strategy of buying and selling under a number of constraints. I am struggling to code my objective using lpsolve().
SAS (Statistical Analysis System) problem solving using SAS software.
Use Weka to do the following: A. Classification and Prediction 1. Classification • Select dataset from UCI/kaggle repository* or from any other source. The first dataset should have continuous value for the class. • Apply on dataset classification with neural networks using backpropagation algorithm. Use various learning parameters with different number of epochs and record your notic...
I am looking for RStudio Expert to help me out with the small task
R Implementing Particle Swarm Optimization to optimize parameters for sports rating system
R Implementing Particle Swarm Optimization to optimize parameters for sports rating system
The data in Table 9.13 are numbers of insurance policies, n, and numbers of claims, y, for cars in various insurance categories, CAR, tabulated by age of policy holder, AGE, and district where the policy holder lived (DIST = 1, for London and other major cities, and DIST = 0, otherwise). The table is derived from the CLAIMS data set in Aitkin et al. (2005) obtained from a paper by Baxter et al. (1...
8.2.) The data in Table 9.13 are numbers of insurance policies, n, and numbers of claims, y, for cars in various insurance categories, CAR, tabulated by age of policy holder, AGE, and district where the policy holder lived (DIST = 1, for London and other major cities, and DIST = 0, otherwise). The table is derived from the CLAIMS data set in Aitkin et al. (2005) obtained from a paper by Baxter et ...
I have a set of articles that I want to analyze with a simple R script. I have done some code but its not working exactly how I want to so I want an expert in R programming to complete the script for me
Recreate methods: dea, [iniciar sesión para ver URL], sdea and malmquist form Package ‘Benchmarking’ from R to Python
To use programming skills and knock down the data and create tools that can ease the process of data analysis.
This questions asks you to estimate the causal effect of tourism on local household incomes in Mexico. To answer this question, we will use Stata/R and the dataset “[iniciar sesión para ver URL]” that you can download from BCourses. This dataset contains 1153 Mexican municipalities that reported some amount of local tourism activity (measured by local hotel sales) in the year ...
Machine learning expert with experience in R
The dataset contains source code of 1.27 million functions mined from C and C++ open-source software and labeled by three selected static analysis tools for the existence or nonexistence of selected CWEs. Need to create machine learning classification models on the dataset, such as: RNN, CNN+RF, RNN+RF. No limited. ** Need good documentation and explanation for each model and evaluation. *The...
The project is devoted to practical issues of "Evaluation of Engineering" course. It is dedicated to statistical analysis of real-world data using using an advanced computational tool-Wolfram Mathematica....
Hello everyone, I will need an expert in Statistics that can do a a regression analysis in R. The project is related to topic modelling. I will send you the analytical requirements and data in chat Best
Portfolio Rebalancing project. I need you to create a code which creates sectorial subindexes for one given big index, like the S&P500. I need a file containing the sectors and the weights of the components of the S&P500 at a given date and the code has to generate n different files with the composition of the n sectorial subindexes with weights rebalanced, where n is the number of differe...
Hey everyone, thank you for reviewing this job post: Our business is currently trying to grow its customer base through optimization and we need to better analyse our website traffic and turnover rate. We have all the data extracted from our platform but we need an statistical analysis expert to be able to analyse these accordingly. Look forward to getting in touch
I want to write a code for a variational autoencoder (with time series data) and I don't know where to start. It is for my thesis so very important. The data consists of multiple timepoints and a lot of different variables per timestep, i dont know how to impute these timepoints. Should I impute them all in once or per timestep > what kind of preprocessing steps should i do > etc.
I'm looking for a freelance to support the new ML division lunch or to join the company. The concept is to use out-of-the-box tools and pre-trained models as much as possible and to create a scalable solution to be delivered to our >400 clients around the world (Luftansa, Swiss, Fiat, MobileEye, Playtica, IronSource...).
Create applications in R Implement vulnerabilities in these applications. Develop secure and insecure solutions for the vulnerable code Create training modules based on the developed code.
I need to run my R code from a website, basically, on some user submission the code executed and the return response to be displayed back on the website
Looking for someone to come in, link R shiny to our web host server! We have developed RShiny apps, and now want to create a website. If you have created a website using R Shiny you are the perfect person for this job! Thank you!
I need to build a classification model (propensity to buy) in SAS Miner or R. Dataset is unbalanced, any model can be used but the outcome must be interpretable. Need the file with propensity outcome. Need also the diagram or r code.
Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.
I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG
Lets discuss more detail via zoom It may help to know that the project is to reproduce one of the tabs depicted here: [iniciar sesión para ver URL]
are you know Rshiny well? Lets discuss more detail via zoom
are you know Rshiny well? if right, it will okay. Lets discuss more detail via zoom
I have the code for the graph itself completed, but need help with the RShiny component of the work (reactives, etc.).
Looking for SAS programmer to guide in my new project
Looking for a SAS programmer who can guide me in my project
Writing a thesis paper, extracting datas and know a statistical software ( Stata or R).
i need someone expert in r programming with some data set in covid 19 related easy task please inbiox