Lenguaje de Programación R Jobs

R is an open source programming language for statistical computing and graphics, it is widely used by statisticians and data miners.

Contratar a R Programmers

Filtro

Mis búsquedas recientes
Filtrar por:
Presupuesto
a
a
a
Tipo
Habilidades
Idiomas
    Estado del trabajo
    79 trabajados encontrados, precios en USD
    $113 Oferta promedio
    11 ofertas
    Complete an excel based project 6 días left
    VERIFICADO

    Requires knowledge of excel ;supply chain ; inventory modeling ; eoq model; stochastic inventory models etc

    $21 (Avg Bid)
    $21 Oferta promedio
    5 ofertas

    Sampling theory & application assignments, 4 questions, not too long

    $21 (Avg Bid)
    $21 Oferta promedio
    9 ofertas
    $61 Oferta promedio
    2 ofertas

    Coding for Real Estate Finance, estimated time for someone experienced: 1-2h. Supporting documents will be provided. I would need it today 8 pm CET. I need R Code with brief comments

    $30 (Avg Bid)
    $30 Oferta promedio
    1 ofertas

    Coding for Real Estate Finance Supporting documents will be provided. I would need it today 11pm CET. Deliverables R Code with brief comments

    $10 - $30
    $10 - $30
    0 ofertas
    Help with STATA 6 días left
    VERIFICADO

    I am doing a research on the effect of asylum seeker reception centers on the property value of nearby houses. For this I need to preform a difference in difference analysis (hedonic price model) in fact it is a multi regression. I need some help with creating dummies and preform some other actions. Is there someone out here that is good with STATA?

    $170 (Avg Bid)
    $170 Oferta promedio
    14 ofertas

    Data Analyst Experte, R Programming gesucht Suche einen Experten für Datenbankenanalyse in R der bei einem privaten Projekt behilflich sein kann. Grob umschrieben die Hilfe zuerst bei 1) Daten Cleaning > Daten auf den selben Nenner bringen, damit sie verglichen werden können und dann 2) die Daten (es handelt sich im Zeitreihendaten für 12 Jahre Zeitraum) mit Hilfe einer passenden...

    $18 / hr (Avg Bid)
    $18 / hr Oferta promedio
    2 ofertas

    Assignment Topic includes Regression, Hypothesis, Scatterplot, Sampling, Confidence Interval, etc

    $12 / hr (Avg Bid)
    $12 / hr Oferta promedio
    13 ofertas

    We are looking for statistics writers for long term work, urgently need to be done a biostatistics task using R programming. Once we contact, you have to provide your previous writing samples (note that not stolen ones). If you are interested, answer the following questions: 1. Your highest education degree and subject? 2. Which types of writing experiences do you have? 3. What referencing styles...

    $12 (Avg Bid)
    $12 Oferta promedio
    3 ofertas

    Need to run Monte Carlo Simulations on the provide data.

    $95 (Avg Bid)
    $95 Oferta promedio
    7 ofertas

    I am trying to evaluate an optimal purchase strategy for a battery storage. I have a data set with bid and ask prices and would like to have the best strategy of buying and selling under a number of constraints. I am struggling to code my objective using lpsolve().

    $81 (Avg Bid)
    $81 Oferta promedio
    9 ofertas
    SAS Program 5 días left

    SAS (Statistical Analysis System) problem solving using SAS software.

    $24 (Avg Bid)
    $24 Oferta promedio
    6 ofertas
    Data Mining - Weka 5 días left
    VERIFICADO

    Use Weka to do the following: A. Classification and Prediction 1. Classification • Select dataset from UCI/kaggle repository* or from any other source. The first dataset should have continuous value for the class. • Apply on dataset classification with neural networks using backpropagation algorithm. Use various learning parameters with different number of epochs and record your notic...

    $169 (Avg Bid)
    $169 Oferta promedio
    14 ofertas
    R Studio Expert is Required 5 días left
    VERIFICADO

    I am looking for RStudio Expert to help me out with the small task

    $18 (Avg Bid)
    $18 Oferta promedio
    8 ofertas

    R Implementing Particle Swarm Optimization to optimize parameters for sports rating system

    $12 / hr (Avg Bid)
    $12 / hr Oferta promedio
    4 ofertas

    R Implementing Particle Swarm Optimization to optimize parameters for sports rating system

    $23 (Avg Bid)
    $23 Oferta promedio
    10 ofertas

    The data in Table 9.13 are numbers of insurance policies, n, and numbers of claims, y, for cars in various insurance categories, CAR, tabulated by age of policy holder, AGE, and district where the policy holder lived (DIST = 1, for London and other major cities, and DIST = 0, otherwise). The table is derived from the CLAIMS data set in Aitkin et al. (2005) obtained from a paper by Baxter et al. (1...

    $55 (Avg Bid)
    $55 Oferta promedio
    2 ofertas

    8.2.) The data in Table 9.13 are numbers of insurance policies, n, and numbers of claims, y, for cars in various insurance categories, CAR, tabulated by age of policy holder, AGE, and district where the policy holder lived (DIST = 1, for London and other major cities, and DIST = 0, otherwise). The table is derived from the CLAIMS data set in Aitkin et al. (2005) obtained from a paper by Baxter et ...

    $73 (Avg Bid)
    $73 Oferta promedio
    3 ofertas

    Need someone who is expert in R language Thanks

    $25 (Avg Bid)
    $25 Oferta promedio
    8 ofertas

    I have a set of articles that I want to analyze with a simple R script. I have done some code but its not working exactly how I want to so I want an expert in R programming to complete the script for me

    $32 (Avg Bid)
    $32 Oferta promedio
    7 ofertas

    Recreate methods: dea, [iniciar sesión para ver URL], sdea and malmquist form Package ‘Benchmarking’ from R to Python

    $10 (Avg Bid)
    $10 Oferta promedio
    1 ofertas

    r coding , data analysis are needed in the project

    $248 (Avg Bid)
    $248 Oferta promedio
    10 ofertas

    To use programming skills and knock down the data and create tools that can ease the process of data analysis.

    $848 (Avg Bid)
    $848 Oferta promedio
    6 ofertas
    Economic,statistics ,R,stata 5 días left
    VERIFICADO

    This questions asks you to estimate the causal effect of tourism on local household incomes in Mexico. To answer this question, we will use Stata/R and the dataset “[iniciar sesión para ver URL]” that you can download from BCourses. This dataset contains 1153 Mexican municipalities that reported some amount of local tourism activity (measured by local hotel sales) in the year ...

    $147 (Avg Bid)
    $147 Oferta promedio
    12 ofertas
    $63 Oferta promedio
    6 ofertas

    The dataset contains source code of 1.27 million functions mined from C and C++ open-source software and labeled by three selected static analysis tools for the existence or nonexistence of selected CWEs. Need to create machine learning classification models on the dataset, such as: RNN, CNN+RF, RNN+RF. No limited. ** Need good documentation and explanation for each model and evaluation. *The...

    $68 (Avg Bid)
    $68 Oferta promedio
    3 ofertas
    R project 4 días left
    VERIFICADO

    See the description from the picture

    $20 (Avg Bid)
    $20 Oferta promedio
    11 ofertas
    Mathematica project -- 2 4 días left
    VERIFICADO

    The project is devoted to practical issues of "Evaluation of Engineering" course. It is dedicated to statistical analysis of real-world data using using an advanced computational tool-Wolfram Mathematica....

    $25 (Avg Bid)
    $25 Oferta promedio
    2 ofertas

    Hello everyone, I will need an expert in Statistics that can do a a regression analysis in R. The project is related to topic modelling. I will send you the analytical requirements and data in chat Best

    $67 (Avg Bid)
    $67 Oferta promedio
    10 ofertas

    Portfolio Rebalancing project. I need you to create a code which creates sectorial subindexes for one given big index, like the S&P500. I need a file containing the sectors and the weights of the components of the S&P500 at a given date and the code has to generate n different files with the composition of the n sectorial subindexes with weights rebalanced, where n is the number of differe...

    $181 (Avg Bid)
    $181 Oferta promedio
    11 ofertas

    Hey everyone, thank you for reviewing this job post: Our business is currently trying to grow its customer base through optimization and we need to better analyse our website traffic and turnover rate. We have all the data extracted from our platform but we need an statistical analysis expert to be able to analyse these accordingly. Look forward to getting in touch

    $61 (Avg Bid)
    $61 Oferta promedio
    3 ofertas

    I want to write a code for a variational autoencoder (with time series data) and I don't know where to start. It is for my thesis so very important. The data consists of multiple timepoints and a lot of different variables per timestep, i dont know how to impute these timepoints. Should I impute them all in once or per timestep > what kind of preprocessing steps should i do > etc.

    $129 (Avg Bid)
    $129 Oferta promedio
    11 ofertas

    I'm looking for a freelance to support the new ML division lunch or to join the company. The concept is to use out-of-the-box tools and pre-trained models as much as possible and to create a scalable solution to be delivered to our >400 clients around the world (Luftansa, Swiss, Fiat, MobileEye, Playtica, IronSource...).

    $56 / hr (Avg Bid)
    $56 / hr Oferta promedio
    1 ofertas
    Application Development on R 4 días left
    VERIFICADO

    Create applications in R Implement vulnerabilities in these applications. Develop secure and insecure solutions for the vulnerable code Create training modules based on the developed code.

    $255 (Avg Bid)
    $255 Oferta promedio
    4 ofertas

    I need to run my R code from a website, basically, on some user submission the code executed and the return response to be displayed back on the website

    $6 / hr (Avg Bid)
    $6 / hr Oferta promedio
    2 ofertas

    Looking for someone to come in, link R shiny to our web host server! We have developed RShiny apps, and now want to create a website. If you have created a website using R Shiny you are the perfect person for this job! Thank you!

    $131 (Avg Bid)
    $131 Oferta promedio
    4 ofertas
    Classification model 3 días left
    VERIFICADO

    I need to build a classification model (propensity to buy) in SAS Miner or R. Dataset is unbalanced, any model can be used but the outcome must be interpretable. Need the file with propensity outcome. Need also the diagram or r code.

    $145 (Avg Bid)
    $145 Oferta promedio
    17 ofertas

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    $109 (Avg Bid)
    $109 Oferta promedio
    30 ofertas
    Genomics Variants Exploration -- 2 3 días left
    VERIFICADO

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $5 / hr (Avg Bid)
    $5 / hr Oferta promedio
    5 ofertas

    Lets discuss more detail via zoom It may help to know that the project is to reproduce one of the tabs depicted here: [iniciar sesión para ver URL]

    $35 (Avg Bid)
    $35 Oferta promedio
    5 ofertas

    are you know Rshiny well? Lets discuss more detail via zoom

    $15 (Avg Bid)
    $15 Oferta promedio
    1 ofertas

    are you know Rshiny well? if right, it will okay. Lets discuss more detail via zoom

    $27 (Avg Bid)
    $27 Oferta promedio
    5 ofertas

    I have the code for the graph itself completed, but need help with the RShiny component of the work (reactives, etc.).

    $10 - $30
    $10 - $30
    0 ofertas
    SAS Programming 2 días left

    Looking for a SAS programmer to work on my Project

    $1176 (Avg Bid)
    $1176 Oferta promedio
    7 ofertas

    Looking for SAS programmer to guide in my new project

    $1267 (Avg Bid)
    $1267 Oferta promedio
    7 ofertas

    Looking for a SAS programmer who can guide me in my project

    $1181 (Avg Bid)
    $1181 Oferta promedio
    4 ofertas
    Thesis Paper -- 2 2 días left
    VERIFICADO

    Writing a thesis paper, extracting datas and know a statistical software ( Stata or R).

    $86 (Avg Bid)
    $86 Oferta promedio
    36 ofertas

    i need someone expert in r programming with some data set in covid 19 related easy task please inbiox

    $128 (Avg Bid)
    $128 Oferta promedio
    12 ofertas
    $366 Oferta promedio
    24 ofertas